NYGH 2020-S3EOY-Bio P1

Class Register Number Name 南洋女子中学校 NANYANG GIRLS’ HIGH SCHOOL End-of-Year Examination 2020 Secondary Three BIOLOGY Paper 1 Multiple Choice 45 minutes Monday 12 October 2020 0845 – 0930 Additional materials: OAS READ THESE INSTRUCTIONS FIRST Do not open this booklet until you are told to do so. Write your name, register number and class at the top of this page and on the OAS in the spaces provided. There are thirty questions in this paper. Answer all questions. For each question there are four possible answers, A, B, C and D. Choose the one you consider correct and record your choice in pencil on the separate OAS provided. Read the instructions on the OAS very carefully. Each correct answer will score one mark. A mark will not be deducted for a wrong answer. Any rough working should be done in this booklet. The use of an approved scientific calculator is expected, where appropriate. Setter: TZZ This document consists of 18 printed pages. NANYANG GIRLS’ HIGH SCHOOL [Turn over

2020 End-of Year-Examination Secondary Three IP 2 Nanyang Girls’ High School IP Biology 1 The diagram shows part of a plant cell. How many phospholipid bilayers will a molecule of oxygen cross to move from organelle X to Y, the outside of the cell? https://www.google.com/imgres?imgurl=http://botit.botany.wisc.edu/Resources/Botany/Plant%2520Cell/Electron%2520Micrographs A 2 B 3 C 5 D 7 2 Which row identifies the function of the structures listed? chloroplast endoplasmic reticulum Golgi apparatus ribosome A photosynthesis protein synthesis protein modification protein secretion B protein transport protein synthesis steroid synthesis photosynthesis C photosynthesis steroid synthesis protein modification protein synthesis D energy release protein synthesis steroid synthesis protein secretion X Y, outside of the cell

2020 End-of-Year-Examination Secondary Three IP 3 Nanyang Girls’ High School IP Biology [Turn over 3 A cell extract was obtained by breaking apart cells to release the organelles. This extract was filtered into a centrifuge tube and then spun in a centrifuge. The heaviest organelles sank to the bottom forming pellet 1, as shown in the diagram. The liquid above pellet 1 was poured into a clean centrifuge tube and spun in the centrifuge at a higher speed to separate the next heaviest organelles. These organelles sank to the bottom, forming pellet 2. This procedure was two more times to obtain pellet 3 and pellet 4. Which row identifies the organelles in each pellet? pellet 1 pellet 2 pellet 3 pellet 4 A nuclei mitochondria ribosomes lysosomes B nuclei mitochondria lysosomes ribosomes C lysosomes mitochondria ribosomes nuclei D ribosomes lysosomes mitochondria nuclei 4 The following shows part of a DNA molecule. Which labelled part is the nucleotide? A B D C liquid above pellet 1 pellet 1

2020 End-of Year-Examination Secondary Three IP 4 Nanyang Girls’ High School IP Biology 5 An mRNA codon for the amino acid alanine is GCG. How many alanine molecules are present in the polypeptide, containing eight amino acids, coded for by the following template strand of DNA? AGCGCGGCCAGCCGCGCGGCGAAT A 0 B 1 C 2 D 3 6 A protein molecule is made up two identical α polypeptide chains and a single β polypeptide chain. The α polypeptide chain consists of 147 amino acids and the β polypeptide chain consists of 146 amino acids. Based on the information, which of the following statement(s) is/are true? 1 There are three genes involved in producing the protein molecule. 2 The synthesis of the protein molecule requires two different mRNAs. 3 The mRNA that codes for the α polypeptide chain is 49 bases long. 4 The gene that codes for the β polypeptide chain is 438 bases long. A 1 only B 1 and 4 only C 2 and 4 only D 2, 3 and 4 only

2020 End-of-Year-Examination Secondary Three IP 5 Nanyang Girls’ High School IP Biology [Turn over 7 A short piece of DNA that is 27 base pairs long was analysed to find the number of bases in each nucleotide strand. The results are shown below. How many bases containing G were present in strand 1? number of nitrogenous bases A G T C strand 1 11 strand 2 7 3 A 3 B 5 C 6 D 8 8 Which of the following about homologous chromosomes is correct? A They are present in all cells. B They have identical alleles. C They have identical genes. D They form pairs during mitosis. 9 Which of the following correctly describes a cell just before mitosis? number of chromatids number of DNA molecules spindle nuclear envelope A 8 4 present present B 8 8 absent present C 4 4 present absent D 4 8 absent absent

2020 End-of Year-Examination Secondary Three IP 6 Nanyang Girls’ High School IP Biology 10 The diagram below shows some cells from a plant. Which of the following statement(s) is/are correct? 1 Anaphase will occur next in cell T. 2 Chromosomes are uncoiling in cell P. 3 Cytokinesis is occurring in cell S. 4 The amount of DNA in cell R is twice that in cell Q. A 1 only B 1 and 2 only C 2 and 4 only D 2, 3 and 4 only Q T P S R

2020 End-of-Year-Examination Secondary Three IP 7 Nanyang Girls’ High School IP Biology [Turn over 11 In fruit flies, the allele for long wings, Q, is dominant over the allele, q, for short wings. Flies which are heterozygous for long wings were mated with flies with short wings. 150 short-winged flies were produced. How many long-winged flies are likely to be produced? A 75 B 150 C 180 D 210 12 Which of the statements about sickle-cell anaemia are correct? 1 People who are heterozygous for sickle cell anaemia are resistant to malaria. 2 The sickle-cell anaemia allele is common in human populations living in malarial prone areas. 3 Sickle-cell anaemia is caused by a mutation in a gene that codes for haemoglobin. 4 Whether a person has sickle cell anaemia or not is dependent on both his genotype and his diet. A 1 and 2 B 1 and 3 C 2 and 3 D 3 and 4

2020 End-of Year-Examination Secondary Three IP 8 Nanyang Girls’ High School IP Biology 13 The pedigree shows the inheritance of the ability to taste a certain chemical. The allele for the ability to taste the chemical is dominant over the allele for the inability to taste it. What is the probability of the second child of Peter and Hannah being a boy and a non-taster? A 0 % B 25 % C 50 % D 75 % 2nd generation 1st generation 3rd generation David Mary Peter Hannah Peter Hannah represents a male ‘taster’ represents a female ‘taster’ represents a male ‘non-taster’ represents a female ‘non-taster’

2020 End-of-Year-Examination Secondary Three IP 9 Nanyang Girls’ High School IP Biology [Turn over 14 Some characteristics about water are listed. 1 good solvent properties 2 high latent heat of vaporisation 3 strong adhesive forces 4 strong cohesive forces Which characteristics about water are important for transport in the xylem? A 1 and 2 only B 2 and 4 only C 3 and 4 only D 1, 3 and 4 only 15 A polypeptide is made up of six amino acids as shown. arginine – leucine – phenylalanine – leucine – glycine – tyrosine Which row correctly identifies the synthesis and structure of the polypeptide? number of condensation reactions involved to form the polypeptide type of linkage number of different R groups in the polypeptide A 5 ester 6 B 5 peptide 5 C 6 ester 6 D 6 peptide 5

2020 End-of Year-Examination Secondary Three IP 10 Nanyang Girls’ High School IP Biology 16 A food label printed on the packaging of a bun is shown. Whi