2025 RI H2 Bio Prelim P1 Answers

© RI 2025 Preliminary Exams 9744/01 [Turn over RAFFLES INSTITUTION 2025 Year 6 Preliminary Examination Higher 2 BIOLOGY 9744/01 Paper 1 Multiple Choice 30th September 2025 1 hour Additional Materials: Multiple Choice Answer Sheet READ THESE INSTRUCTIONS FIRST Write in soft pencil. Do not use staples, paper clips, highlighters, glue or correction fluid. Write your name and shade your Index Number on the Answer S heet in the spaces provided unless this has been done for you. There are thirty questions in this paper. Answer all questions. For each question there are four possible answers A, B, C, and D. Choose the one you consider correct and record your choice in soft pencil on the separate Answer Sheet. Read the instructions on the Answer Sheet very carefully. Each correct answer will score one mark. A mark will not be deducted for a wrong answer. Any rough working should be done in this booklet. Calculators may be used. (Erase all mistakes completely. Do not bend or fold the OMR Answer Sheet). This document consists of 22 printed pages. Raffles Institution Internal Examination

2 © RI 2025 Preliminary Exams 9744/01 1. The diagram shows a triglyceride. An enzyme was used to digest this triglyceride into glycerol and fatty acids. Which scatter plot correctly represents each fatty acid component of the triglyceride?

3 © RI 2025 Preliminary Exams 9744/01 [Turn over 2. A student carried out an experiment to investigate the effect of pH on an enzyme -catalysed reaction. The optimum condition for this enzyme is the acidic environment of the stomach at pH 1-2. The remaining substrate concentration was measured after 5 minutes at each different pH. Which graph shows the effect of increasing pH on substrate concentration remaining after five minutes?

4 © RI 2025 Preliminary Exams 9744/01 3. The micrograph below shows some organelles and storage molecules in a mammalian liver cell. Which of the following statements about the labelled structures/ molecules is incorrect? A Biomolecule A is a storage polysaccharide, glycogen. B Structures B and C are the same organelle, just sectioned at different planes. C Structure D is attached to a membrane and responsible for protein synthesis. D The inner membrane of C has an identical composition as the membrane that D is attached to. A B C D

5 © RI 2025 Preliminary Exams 9744/01 [Turn over 4. The diagram shows how nicotine is transported from the blood plasma into a cell using a type of cotransporter mechanism. With reference to the figure above, which statement best describes the transport of nicotine? A The cotransporter protein generates a proton gradient by moving protons out of the cell by active transport. B The protons are transported through the cotransporter protein by facilitated diffusion. C The c otransporter protein uses the energy stored in the proton gradient to drive the movement of nicotine. D The cotransporter protein uses energy from ATP to transport protons with nicotine.

6 © RI 2025 Preliminary Exams 9744/01 5. The simplified schematic diagram below shows 3 stages in a cell cycle. Which of the following graphs best matches the changes in the DNA content per cell, in the three stages? III II I DNA content per cell I II III Stage 2 1 DNA content per cell III I II Stage 2 1 DNA content per cell III I II Stage 2 1 DNA content per cell I II III Stage 2 1 A B C D

7 © RI 2025 Preliminary Exams 9744/01 [Turn over 6. Turner syndrome is a genetic disorder affecting only females. It causes symptoms such as short stature, elbow deformity and sterility. A girl with Turner syndrome produced the following karyogram. [Credit: Wessex Reg. Genetics Centre. Attribution 4.0 International (CC BY 4.0)] This condition resulted from non-disjunction occurring in anaphase I of meiosis in an egg cell. Two cells resulted from the first division. O ne of the cells led to Turner syndrome. Which chromosomes will be in the other cell (polar body) at the end of meiosis I? A 44 autosomes and X B 44 autosomes and XX C 22 autosomes and X D 22 autosomes and XX

8 © RI 2025 Preliminary Exams 9744/01 7. The following sequence of template DNA is taken randomly from a bacterial genome. 5’ TTACGCTTCGAAATAGGAATATCATAGGCT 3’ What would be the first four amino acids of a polypeptide generated from this sequence? The mRNA codons for some amino acids are shown in the table below: Arg CGA, CGG, AGA, AGG Leu CUU, CUC, CUA, CUG Asp GAU, GAC Lys AAA, AAG Ile AUU, AUC, AUA Phe UUU, UUC Start AUG Ser UCA, UCG, AGU, AGC Stop UAG, UGA, UAA Tyr UAU, UAC A Met-Arg-Ser-Phe B Met-Arg-Ser-Lys C Met-Ile-Phe-Leu D Met-Tyr-Lys-Asp 8. The table describes different types of mutations in DNA. mutation name from purine to other purine from pyrimidine to other pyrimidine from purine to pyrimidine from pyrimidine to purine transition transition transversion transversion The diagram represents part of a DNA molecule. A – T A – T C – G C – G Which diagram shows the DNA molecule after a transition has occurred? A I only B I and II only C III only D III and IV only

9 © RI 2025 Preliminary Exams 9744/01 [Turn over 9. Which set of statements correctly describes the transfer of DNA from one bacterium to another? binary fission transduction conjugation A only plasmids pass to daughter cells DNA transferred by bacteriophage from one bacterium to another single strand of F plasmid transferred from one bacterium to another B only plasmids pass to daughter cells bacterial cell takes up foreign DNA from culture medium double strand of F plasmid transferred from one bacterium to another C daughter cells inherit bacterial chromosome and plasmids DNA transferred by bacteriophage from one bacterium to another single strand of F plasmid transferred from one bacterium to another D daughter cells inherit bacterial chromosome and plasmids bacterial cell takes up foreign DNA from culture medium double strand of F plasmid transferred from one bacterium to another 10. The trp operon is an example of a repressible operon found in the E. coli. E. coli cells were irradiated by UV light, leading to mutations in their genomes. In some of these cells, mutated trp R regulatory genes led to the constitutive expression of active repressor proteins, due to a conformation change in their DNA binding sites. Which of the following modification(s) could restore the normal regulation of the trp operon? I Induce a loss of function mutation in the promoter site of the existing mutated trp R gene. II Induce a loss of function mutation in the promoter site of the existing trp R gene and insertion of a functional trp R gene with its own promoter. III Replace, via homologous recombination, the existing operator sequence with a mutated operator sequence, without affecting the promoter region. IV Culture the mutated E. coli ce