2025 EJC Prelim H2 9744 Biology P1 (Final Answers)

©EJC 2025 9744/01/J2H2PRELIM/2025 [Turn over EUNOIA JUNIOR COLLEGE JC2 Preliminary Examination 2025 General Certificate of Education Advanced Level Higher 2 H2 Biology Paper 1 Multiple Choice 9744/01 22 September 2025 1 hour Additional Materials: Multiple Choice Answer Sheet READ THESE INSTRUCTIONS FIRST Write in soft pencil. Do not use paper clips, glue or correction fluid/tape. Write your name, civics group and registration number on the Answer Sheet in the spaces provided. There are thirty questions on this paper. Answer all questions. For each question there are four possible answers A, B, C and D. Choose the one you consider correct and record your choice in soft pencil on the separate Answer Sheet. Read the instructions on the Answer Sheet very carefully. Each correct answer will score one mark. A mark will not be deducted for a wrong answer. Any rough working should be done in this booklet. The use of an approved scientific calculator is expected, where appropriate. This document consists of 22 printed pages and 1 blank pages.

2 ©EJC 2025 9744/01/J2H2PRELIM/2025 Answer all questions. 1 The diagram shows two identical molecules of glucose which are involved in the formation of glycogen. The possible bonding positions in the two molecules are labelled p, q, r, s, t, u, v and w. When the two molecules condense during the formation of glycogen, where could bonds form? A p – u or r – v B s – t or q – u C s – w or q – t D q – w or p – u 2 The diagram shows a triglyceride molecule that has been partially hydrolysed. What will be the products of the total hydrolysis of the molecule shown? A a molecule of glycerol and a saturated fatty acid molecule only B a molecule of glycerol and an unsaturated fatty acid molecule only C a molecule of water, a molecule of glycerol and a saturated fatty acid molecule D a molecule of water, a molecule of glycerol and an unsaturated fatty acid molecule p q r s t u v w

3 ©EJC 2025 9744/01/J2H2PRELIM/2025 [Turn over 3 A peptide section of an insulin molecule was hydrolysed by two proteases, trypsin and chymotrypsin. • Trypsin breaks the peptide bonds at the carboxyl terminals of lysine (lys) and arginine (arg). • Chymotrypsin breaks the peptide bonds at the carboxyl terminals of phenylalanine (phe), tryptophan (trp) and tyrosine (tyr). The hydrolysis was performed separately using: (i) both enzymes, or (ii) trypsin only, or (iii) chymotrypsin only. The sequence of amino acid residues in the peptide is shown below: Which statement concerning the products of hydrolysis is correct? A Fewer than half of the fragments from hydrolysis (i) are single amino acids. B Hydrolysis (ii) yields one fewer fragment than hydrolysis (iii). C Hydrolysis (ii) yields one more dipeptide than hydrolysis (iii). D With hydrolysis (i), all fragments formed are seven or fewer amino acid residues long. 4 The graphs show the effects of temperature and pH on enzyme activity. Which statement is a correct explanation of the rate of reaction at the point shown? A At P, hydrogen bonds in the enzyme are broken. B At Q, the kinetic energy of enzyme and substrate is highest. C At R, covalent bonds are formed between enzyme and substrate. D At S, ionic bonds in the enzyme are broken. amino terminal tyr-leu-val-cys-gly-glu-arg-gly-phe-phe-tyr-thr-pro-lys-ala carboxyl terminal

4 ©EJC 2025 9744/01/J2H2PRELIM/2025 5 A researcher is studying the properties of a toxin produced by a plant. When cellular contents are exposed to the toxin, the cell will die. The table shows the relative proportion of various structures in cells that are not actively producing the toxin and cells that are actively producing the toxin. Cell structure description relative proportion of cell / % non-toxin producing cell toxin producing cell W double membrane-bound organelle with cristae 12 15 X sheet-like, membrane-bound organelle with continuous lumen 15 20 Y membrane-bound organelle arranged in tubules 14 3 Z large, dense, and contains rRNA 3 10 Which conclusion is consistent with the data provided above? A Toxin production is energy intensive, which requires more of structure W. B Protein synthesis at structure X is upregulated, implying that the toxin is protein-based and embedded in the membrane of structure X. C The decrease in structure Y is due to transport vesicles containing the toxin budding off. D Increased ribosome production in structure Z suggests that the toxin is RNA-based.

5 ©EJC 2025 9744/01/J2H2PRELIM/2025 [Turn over 6 A graticule and a micrometer scale can be used to measure the size of biological structures that are viewed with a microscope. Which row shows the correct locations for the placement of a graticule and a micrometer scale on the microscope shown? graticule micrometer scale A 1 3 B 2 1 C 2 3 D 3 1

6 ©EJC 2025 9744/01/J2H2PRELIM/2025 7 The diagram shows part of a cell surface membrane. Which row correctly matches the function of the molecules labelled 1 and 2? 1 = glycoprotein 2 = phospholipid A acts as a binding site for other cells ✔ limits the permeability of the membrane ✔ B acts as a recognition site for other cells ✔ transports water across the membrane ✘ C restricts membrane fluidity at high temperature ✘ transports ions across the membrane ✘ D improves membrane fluidity at low temperature ✘ limits the permeability of the membrane ✔ 8 A circular DNA molecule comprises 1700 base pairs and has equal numbers of A, T, C, and G. What is the total number of hydrogen bonds and phosphodiester bonds present in this DNA molecule? A 5949 B 5950 C 7648 D 7650 9 Which statements correctly describe the process of translation? 1 A section of DNA is copied into an mRNA molecule by RNA polymerase. ✘ 2 A polypeptide is produced because ribosomal RNA joins adjacent amino acids. ✔ 3 The nucleotide sequence on an mRNA molecule is used to produce a specific amino acid chain. ✔ 4 A polypeptide is produced because anticodons on tRNA molecules attach to mRNA codons through peptide bonds. ✘ A 1 and 3 B 2 and 3 C 1, 2 and 3 D 1, 2, 3 and 4

7 ©EJC 2025 9744/01/J2H2PRELIM/2025 [Turn over 10 Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β -globin polypeptide of haemoglobin. The diagram shows the sequence of bases in a small section of the template strand of DNA for both the HbA (normal) and HbS (sickle cell) β-globin alleles. HbA CTGACTCCTGAGGAGAAGTCT HbS CTGACTCCTGTGGAGAAGTCT Both the polypeptides for HbA and HbS are the same length. How will the mutation in the allele result in the production of an altered version of the β-globin polypeptide? A A tRNA molecule with the anticodon GUG will form hydrogen bonds with the altered codon on mRNA. B All the amino acids coded for after the mutation will differ from those in the HbA protein. C mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC. D The ribosome will be unable to continue translation of the HbS mRNA after the altered codon. 11 The diagram shows an outline of the mitotic cell cycle. Which numbered stages of the cell cycle include a period of time when each chromosome consists of sister chromatids joined by a centromere? A 2 only B 1 and 2 C 1 and 3 D 2 and 3

8 ©EJC 2025 9744/01/J2H2PRELIM/2025 12 Which row correctly shows a representation of one chromosome at the beginning of prophase I and at the end of anaphase II of meiosis and the number of DNA st