2018_Mutations_MCQ_QP+MS

2018 Mutations MCQ2018 / H2 / AJC PRELIM / P1 Q151Tay-Sachs disease is a fatal neurodegenerative disease which is caused by a mutation in the hexosaminidase A (Hex A) gene located on chromosome 15. Part of the sequence of the non-template (coding) DNA strand of the normal Hex A allele and the mutated Tay-Sachs allele are shown below. The sequences are the same as the mRNA sequence of both alleles.DNA sequences of normal Hex A allele:Amino acid position424425426427428429430431Non-template DNA5’…CGTATATCCTATGGCCCTGACTGT…3’DNA sequences of mutated Tay-Sachs allele:Amino acid position424425426427428429430431Non-template DNA5’…CGTATATCTATCCTATGGCCCTGA…3’For both alleles, 9 different amino acids are encoded for by the DNA triplets:Amino acidDNA tripletAmino acidDNA tripletArgCGTLeuCTAAspGACProCCC, CCTCysTGG, TGTSerTCC, TCTGlyGGCTyrTATIleATA, ATCStop codonTAG, TAA, TGAWhich statement is true?AThe disease is caused by the deletion of one DNA nucleotide.BThe Hex A protein encoded for by the Tay-Sachs allele is non-functional due to a frameshift mutation.CThe polypeptide encoded for by the Tay-Sachs allele has the same number of amino acids as that encoded by the normal Hex A allele.DAt amino acid position 431, there is a silent mutation.2018 / H2 / AJC PRELIM / P1 Q162Edwards’ syndrome is a common autosomal disorder caused by chromosome aberration.Edwards’ syndrome is a trisomy of chromosome 18 that affects all cells.The extra chromosome is most often of maternal origin.

In approximately more than 50% of individuals diagnosed with the syndrome, two of the three chromosomes 18 present are found to be nearly genetically identical. What can be correctly concluded from this information? ANon-disjunction of chromosome 18 commonly occurs during gamete formation in females.BNon-disjunction of chromosome 18 occurs more frequently during meiosis I than in meiosis II.CNon-disjunction of chromosome 18 occurs most commonly in female embryos. DTwo of the three chromosomes 18 are nearly genetically identical due to uneven crossing over resulting in chromosomal translocation.2018 / H2 / EJC PRELIM / P1 Q53The figures below show the complete karyotypes of 2 rodents of the same species. In this species of rodents, males are heterogametic. Rodent A (Male) Rodent B (Female)Which of the following observations is not true?AA chromosomal aberration occurred in the ovary of the mother of rodent B.BRodent A is diploid and 2n = 16.CRodent B has 1 missing X chromosome.DNon-disjunction of autosomes occurred in rodent B.

2018 / H2 / IJC PRELIM / P1 Q164Down’s syndrome can be caused by a trisomy of chromosome 21, but can also result from translocation of chromosome 21 onto chromosome 13, forming a single chromosome 13-21.The diagram shows chromosomes 13 and 21 in the nucleus of a diploid (2n) testis cell from a phenotypically normal male carrier of a 13-21 translocation. This cell has a chromosome number of 45. Which is not a likely outcome of fertilisation of normal oocytes by