2015 RI H2 Biology Prelims Paper 1 Questions

© RI 2015 Preliminary Examination 9648/01 [Turn over RAFFLES INSTITUTION 2015 Year 6 Preliminary Examination Higher 2 BIOLOGY 9648/01 Paper 1 Multiple Choice 29 September 2015 1 hour 15 min Additional Materials: Multiple Choice Answer Sheet READ THESE INSTRUCTIONS FIRST Write in soft pencil. Do not use staples, paper clips, highlighters, glue or correction fluid. Write your name and shade your Index Number on the Answer Sheet in the spaces provided. There are forty questions in this paper. Answer all questions. For each question there are four possible answers A, B, C, and D. Choose the one you consider correct and record your choice in soft pencil on the separate Answer Sheet. Read the instructions on the Answer Sheet very carefully. Each correct answer will score one mark. A mark will not be deducted for a wrong answer. Any rough working should be done in this booklet. Calculators may be used. (Erase all mistakes completely. Do not bend or fold the Answer Sheet). This document consists of 24 printed pages. Raffles Institution Internal Examination

2 © RI 2015 Preliminary Examination 9648/01 1 A sample of yeast cells was grown in a culture. Radioactive amino acids were added to the solution in which they were being grown. At various times, samples of the cells were taken and the amount of radioactivity in different organelles was measured. The results are shown in the table. Time after radioactive amino acids were added to the solution / min Amount of radioactivity present / arbitrary units P Q R 1 21 120 6 20 42 68 6 40 86 39 8 60 76 28 15 90 50 27 28 120 38 26 56 Which best describes the identities of organelles P, Q and R? P Q R A Golgi apparatus Rough endoplasmic reticulum Secretory vesicles B Rough endoplasmic reticulum Smooth endoplasmic reticulum Golgi apparatus C Nucleus Rough endoplasmic reticulum Golgi apparatus D Smooth endoplasmic reticulum Golgi apparatus Secretory vesicles 2 The key below can be used to identify carbohydrates. (1) Sugars……………………………………… go to (2) Polysaccharides ……………………..…… go to (4) (2) Monosaccharides ..……..…………………. A Disaccharides ……………………………... go to (3) (3) Contains only 1 type of monomer……….. B Contains only 2 types of monomer…....… sucrose (4) Structural function…………………………. go to (5) Storage function ……….………………….. go to (6) (5) Structural function in plants..….………….. C Structural function in animals..….……...... collagen (6) Storage function in plants..….……………. starch Storage function in animals..….….………. D Which of the above is maltose?

3 © RI 2015 Preliminary Examination 9648/01 [Turn over 3 The diagram below shows part of a protein molecule. Which of the following statement(s) is/are correct? I Bonds X and Y are both affected by substitution of an amino acid. II Only Bond Y may be affected by a base deletion. III Amino acids with bulky R groups may prevent Bond X from forming. IV Formation of Bond X is affected by insertion of three bases. A I and IV only B II only C II and III only D All of the above

4 © RI 2015 Preliminary Examination 9648/01 4 Lactic dehydrogenase catalyses the conversion of lactic acid as shown in the following equation. Two forms (isomers) of lactic acid exist, (-) and (+), as shown below. Reduced NAD absorbs ultraviolet light. NAD does not. The activity of bacterial lactic dehydrogenase on two different isomers of lactic acid was compared. The absorbance of ultraviolet light was measured using an ultraviolet spectrophotometer. The graphs show the results. What can be concluded about bacterial lactic dehydrogenase? A Molecules of both isomers fit the active site. B Molecules of neither isomer fit the active site. C The enzyme is specific to the (-) isomer. D The enzyme is specific to the (+) isomer.

5 © RI 2015 Preliminary Examination 9648/01 [Turn over 5 The figures below show cells obtained from various stages of nuclear division of a diploid organism. Cell A is undergoing anaphase II of meiosis. Which statement correctly describes cells B to D? A Cell B is undergoing metaphase of mitosis. B Cell C is obtained from a cell that has been treated with colchicine. C Cells C and D are undergoing the same type of nuclear division. D Cell D shows a diploid cell. Cell C Cell D Cell B

6 © RI 2015 Preliminary Examination 9648/01 6 The diagram shows the life cycle of an organism. The numbers show how many chromosomes are present in one cell at each stage of the life cycle. Which of the following correctly shows the type of division and number of chromosomes? Type of cell division Number of chromosomes T X Y A Mitosis 16 8 B Meiosis 16 16 C Mitosis 32 32 D Mitosis 32 16

7 © RI 2015 Preliminary Examination 9648/01 [Turn over 7 The diagram below represents some biochemical reactions involved in protein synthesis. Which of the following is correct? Entire molecule coded directly from DNA is represented by 5’ end of molecule Enzyme involved in catalysing bond 5 A 1 and 2 Z peptidyl transferase B 1 and 2 Y aminoacyl tRNA synthethase C 1, 2 and 3 X aminoacyl tRNA synthethase D 1, 2 and 4 W peptidyl transferase 8 Imagine that you discovered an organism which has DNA that contains two other nucleotide bases in addition to A, T, C and G. These two nucleotide bases form a base pair, so that the DNA contains six different bases which form three base pairs. What would be the maximum number of amino acids that its DNA can code for, assuming that there are three stop codons and that there are three bases per codon? A 15 B 61 C 213 D 726 W X Y Z

8 © RI 2015 Preliminary Examination 9648/01 9 Which of the following is the correct physiological substrate for DNA polymerase? A B C D

9 © RI 2015 Preliminary Examination 9648/01 [Turn over 10 What protein would be coded by the following DNA molecule? 5’ – CCTACTATGCGCCAGTATAAGTGACAATTA – 3’ 3’ – GGATGATACGCGGTCATATTCACTGTTAAT – 5’ A Met – Arg – Gln – Tyr – Lys B Met – Arg – Gln – Lys – Lys C Met – Lys – Arg – Gly – Gln – Lys – His – Arg D Met – Ile – Arg – Gly – His – Ile – His – Cys 11 The genome of Ebola virus is a single -stranded RNA molecule whose sequence is complementary to the RNA sequence which functions as a viral messenger RNA. Which of the following explains how capsomeres of the virus is synthesised? A The genomic RNA is used for translation to produce capsomeres. B mRNA is synthesised by reverse transcription of the genomic RNA which is then used for translation to produce capsomeres. C RNA dependent RNA polymerase transcribes genomic RNA to mRNA which is used for translation to produce capsomeres. D Genomic RNA reverse transcribed to dsDNA and integrates into the chromosome. Upon activation, the viral genes are transcribed to mRNA which is translated to capsomeres.

10 © RI 2015 Preliminary Examination 9648/01 12 Which statement about bacteriophage is false? A Bacteriophages can reproduce via the lytic or lysogenic cycle, but not both. B Bacteriophages are capable of undergoing genetic recombination. C Temperate bacte