2018 RVHS H2 Biology Prelims Paper 2 Answers

1 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination RIVER VALLEY HIGH SCHOOL YEAR 6 PRELIMINARY EXAMINATION CANDIDATE NAME CENTRE NUMBER S CLASS INDEX NUMBER H2 BIOLOGY 9744/02 Paper 2 Structured Questions 10 Sep 2018 2 hours Candidates answer on the Question Paper. No Additional Materials are required. READ THESE INSTRUCTIONS FIRST Write your Centre number, index number and name in the spaces at the top of this page. Write in dark blue or black pen. You may use an HB pencil for any diagrams or graphs. Do not use staples, paper clips, glue or correction fluid. DO NOT WRITE IN ANY BARCODES. Answer all questions in the spaces provided on the Question Paper. The use of an approved scientific calculator is expected, where appropriate. You may lose marks if you do not show your working or if you do not use appropriate units. At the end of the examination, fasten all your work together. The number of marks is given in brackets [ ] at the end of each question or part question. For Examiner’s Use 1 / 6 2 / 11 3 /12 4 / 8 5 / 12 6 / 10 7 / 10 8 / 11 9 / 10 10 /5 11 /5 Total / 100 _____________________________________________________________________ This document consists of 24 printed pages.

2 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination Answer all questions. 1 Fig.1.1 shows a cell undergoing telophase and process X simultaneously. Fig. 1.1 Source: David M. Phillips, 2014 (a) Name structure A. [1] mitochondrion (b) Name process X and explain how it supports the cell theory. [2] 1. Cytokinesis 2. The process shows that all cells come from pre-existing cells

3 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination (c) Outline the role of A and explain its significance to process X. [3] 1. (Site of) ATP synthesis; 2. during aerobic respiration 3. Provide energy 4. to form contractile ring of filaments 5. to form cleavage furrow 6. so as to separate the cell (into two) [Total: 6]

4 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination 2 (a) Explain how the structure of fatty acids allow triglycerides to be a good store of energy. [2] Fatty acids makes triglycerides 1. (S) non-polar/uncharged/large/long hydrocarbon chain 2. (F) can be stored (in large amounts) without having any significant effect on the water potential of a cell 3. (S) have large number of hydrogen atoms 4. (F) store large amounts of energy

5 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination Fig. 2.1 shows the structure of a lipoprotein. Lipoproteins transport fats from the liver to other tissues via the bloodstream. The proteins of lipoproteins play an important role in the deposition of fats to the correct tissue. Fig. 2.1 (b) Describe how lipoproteins allow for the transport of fats from the liver to a specific tissue via blood. [4] 1. Phospholipid molecules form a single layer 2. Non polar / hydrophobic hydrocarbon tail interact with (non polar / hydrophobic) fats 3. Polar / hydrophilic phosphate head interact with the (aqueous) blood 4. Membrane protein binds to cell of target tissue 5. via complementary shape

6 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination Fig. 2.2 shows a protein embedded in a phospholipid bilayer. Fig. 2.2 Source: Adapted from RCSB Protein Data Bank (c) With reference to Fig. 2.2, (i) name the secondary structure and describe the bonding involved, and [3] 1. β-pleated sheet 2. held in place by hydrogen bonds 3. between (O atom of) C=O and (H atom of) N-H groups 4. at regular intervals 5. of polypeptide chain parallel to each other

7 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination (ii) describe how the structure of haemoglobin differs from that of the protein in Fig. 2.2. [2] Haemoglobin Protein in Fig 2.2 Level of protein structure Quaternary Tertiary Secondary structure Largely α-helices Largely β-pleated Amino acids arrangement Hydrophilic amino acids on the surface of protein. Both hydrophobic and hydrophilic amino acids on the surface of protein Haem group Presence of haem group No haem group [Total: 11] 3 Fig. 3.1 shows the structure of a tRNA. Source: Biochem, Seventh edition, 2012 Fig. 3.1

8 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination (a) Describe how the structure of tRNA allows for its role in translation. [4] 1. 3’ CCA end of tRNA 2. Serve as attachment site of a specific amino acid 3. Contains anticodon at one end 4. Specifies the identity of amino acid attached to (the 3’ CCA end of the) tRNA 5. (Sequence of bases of) anticodon able to complementary base pair 6. With the corresponding mRNA codon 7. (T) loop 8. binds to rRNA of ribosome (via base-pairing) 9. (D) loop 10. for binding to amino-acyl tRNA synthetase (that attaches tRNA with its specific amino acid) 11. tRNA folds into a clover-leaf shape (2-D structure)/L-shape (3-D structure) 12. to reduce steric hindrance

9 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination Synthetic RNA, which binds to bacterial mRNA, could interfere with translation. Fig. 3.2 shows the sequences of a bacterial mRNA and two different synthetic RNA. Bacterial mRNA Synthetic RNA 1 Synthetic RNA 2 Fig. 3.2 (b) With reference to Fig. 3.2, suggest how synthetic RNA binds to mRNA. [1] Synthetic RNA and mRNA 1. forms hydrogen bonds 2. between complementary base-pair The effectiveness of synthetic RNA 1 and 2 are investigated by introducing them to separate bacterial cultures and incubating for 24 hours. The results of the investigation is shown in Fig. 3.3. Fig. 3.3 5’- GUCAACCAUGCCAAUUAUCACGGACAUUCAUGGUAGGCCUUAGUAGACAACUG-3’ 5’- CAGUUGUCUA-3’ 5’- CUAGGUUGAC-3’

10 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination (c) With reference to Fig. 3.2 and Fig. 3.3, explain the results of the investigation. [6] 1. Synthetic RNA 1 will bind to 3’ end of bacterial mRNA 2. Ribosome can still bind to 5’ end of mRNA 3. Stabilises mRNA 4. Polypeptide for growth synthesised 5. for cell to divide / undergo binary fission 6. Synthetic RNA 2 will bind to 5’ end of bacterial mRNA 7. to form double stranded RNA 8. Block binding of ribosome to (5’ end) mRNA (for translation)/block AUG 9. Proteins for normal cellular functions not produced 10. killing bacteria (d) Suggest a limitation of using synthetic RNA as an oral antibiotic for bacterial infections in humans. [1] 1. Synthetic RNA broken down during digestion 2. Kills good bacteria in gut 3. Enters human cells and inhibit translation [Total: 12]