2018 RVHS H2 Biology Prelims Paper 2 Questions

1 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination RIVER VALLEY HIGH SCHOOL YEAR 6 PRELIMINARY EXAMINATION CANDIDATE NAME CENTRE NUMBER S CLASS INDEX NUMBER H2 BIOLOGY 9744/02 Paper 2 Structured Questions 10 Sep 2018 2 hours Candidates answer on the Question Paper. No Additional Materials are required. READ THESE INSTRUCTIONS FIRST Write your Centre number, index number and name in the spaces at the top of this page. Write in dark blue or black pen. You may use an HB pencil for any diagrams or graphs. Do not use staples, paper clips, glue or correction fluid. DO NOT WRITE IN ANY BARCODES. Answer all questions in the spaces provided on the Question Paper. The use of an approved scientific calculator is expected, where appropriate. You may lose marks if you do not show your working or if you do not use appropriate units. At the end of the examination, fasten all your work together. The number of marks is given in brackets [ ] at the end of each question or part question. For Examiner’s Use 1 / 6 2 / 11 3 /12 4 / 8 5 / 12 6 / 10 7 / 10 8 / 11 9 / 10 10 /5 11 /5 Total / 100 _____________________________________________________________________ This document consists of 24 printed pages.

2 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination Answer all questions. 1 Fig.1.1 shows a cell undergoing telophase and process X simultaneously. Fig. 1.1 Source: David M. Phillips, 2014 (a) Name structure A. [1] (b) Name process X and explain how it supports the cell theory. [2]

3 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination (c) Outline the role of A and explain its significance to process X. [3] [Total: 6]

4 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination 2 (a) Explain how the structure of fatty acids allow triglycerides to be a good store of energy. [2] Fig. 2.1 shows the structure of a lipoprotein. Lipoproteins transport fats from the liver to other tissues via the bloodstream. The proteins of lipoproteins play an important role in the deposition of fats to the correct tissue. Fig. 2.1 (b) Describe how lipoproteins allow for the transport of fats from the liver to a specific tissue via blood. [4]

5 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination Fig. 2.2 shows a protein embedded in a phospholipid bilayer. Fig. 2.2 Source: Adapted from RCSB Protein Data Bank (c) With reference to Fig. 2.2, (i) name the secondary structure and describe the bonding involved, and [3] (ii) describe how the structure of haemoglobin differs from that of the protein in Fig. 2.2. [2] [Total: 11]

6 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination 3 Fig. 3.1 shows the structure of a tRNA. Source: Biochem, Seventh edition, 2012 Fig. 3.1 (a) Describe how the structure of tRNA allows for its role in translation. [4]

7 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination Synthetic RNA, which binds to bacterial mRNA, could interfere with translation. Fig. 3.2 shows the sequences of a bacterial mRNA and two different synthetic RNA. Bacterial mRNA Synthetic RNA 1 Synthetic RNA 2 Fig. 3.2 (b) With reference to Fig. 3.2, suggest how synthetic RNA binds to mRNA. [1] 5’- GUCAACCAUGCCAAUUAUCACGGACAUUCAUGGUAGGCCUUAGUAGACAACUG-3’ 5’- CAGUUGUCUA-3’ 5’- CUAGGUUGAC-3’

8 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination The effectiveness of synthetic RNA 1 and 2 are investigated by introducing them to separate bacterial cultures and incubating for 24 hours. The results of the investigation is shown in Fig. 3.3. Fig. 3.3 (c) With reference to Fig. 3.2 and Fig. 3.3, explain the results of the investigation. [6] (d) Suggest a limitation of using synthetic RNA as an oral antibiotic for bacterial infections in humans. [1] [Total: 12]

9 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination 4 Morbillivirus, which causes measles, has a structure as shown in Fig. 4.1. Fig. 4.1 Source: UCLES, 2016 Morbillivirus only infects cells that have a membrane glycoprotein known as signaling lymphocyte activation protein (SLAM). When Morbillivirus infects a cell, H acts before F. (a) State how the structure of Morbillivirus envelope is similar to that of human immunodeficiency virus (HIV). [2]

10 River Valley High School Year 6 H2 Biology 9744 Paper 2 2018 Preliminary Examination (b) Morbillivirus and HIV utilise a similar mechanism to enter host cells. Describe how Morbillivirus enters a host cell. [3] (c) Describe how the Morbillivirus genome enables the Morbillivirus reproductive cycle. [3] [Total: 8]