Dec Revision Questions H2 2024 J1 ASRJC BIO

Anderson Serangoon Junior College Biology Department 1 JC1 H2 BIOLOGY December Revision Package 2024 JC1 H2 BIOLOGY DECEMBER REVISION PACKAGE NAME: ………………………………………………… CLASS: ………………………… Topic: CELLULAR STRUCTURES AND FUNCTION Question 1 [6 marks] TJC Prelims 2009 The electron micrograph in Fig. 1.1 shows an acinar cell found in the pancreas. Fig. 1.1 (a) With reference to Fig. 1.1, suggest the principal function of the pancreatic acinar cell. Give two reasons to explain your answer. [3]

Anderson Serangoon Junior College Biology Department 2 JC1 H2 BIOLOGY December Revision Package Fig. 1.2 shows two different structures, A and B, found in an animal cell. Fig. 1.2 (b) (i) Describe two ways in which A is similar to B. [2] (ii) The products of B are usually in the inactive form. Suggest the significance of this. [1] A B

Anderson Serangoon Junior College Biology Department 3 JC1 H2 BIOLOGY December Revision Package Topic: BIOMOLECULES AND CELL MEMBRANE Question 2 [11 marks] The figure below shows two molecules of glucose. (a) Draw the resulting maltose molecule arising from a dehydration reaction. [1] (b) Label the resulting bond. [1] Starch, a storage molecule in plants, is a polymer made of glucose molecules joined together. It consists of two components. (c) Name these two components. [2] (d) (i) Give one similarity between these two components. [1] (ii) Give two differences between these two components. [2] (f) The following figure shows a section of a cell surface membrane. (i) Explain why membranes are described as fluid mosaic in structure. [2] (ii) Some molecules are able to pass through the plasma membrane without the facilitation of transport proteins. Describe the unique properties of these molecules. [1] (iii) Outline two other roles of membrane proteins apart from their role in transport. [2]

Anderson Serangoon Junior College Biology Department 4 JC1 H2 BIOLOGY December Revision Package Topic: ENZYMES Question 3 [ 7 marks] JJC Prelims 2009 Meat is the muscle of an animal. When animals are slaughtered, biochemical changes occur in the muscles, resulting in the hardening of meat. There are several ways to make the meat tender again, and these usually involve the partial breaking down of the proteins that make up the muscle tissue. One way is to add the protein-digesting enzyme, papain, just before freezing the meat. As the meat is thawed and cooked, this enzyme digests the protein. (a) Suggest how the protein may be held in the active site of a papain while the reaction occurs. [2] (b) Use your knowledge of enzymes to explain: (i) Why the rate at which protein is digested increases as the meat warms up in the early stages of cooking. [2] (ii) Why protein digestion stops once the meat has been heated to 90oC. [3] Question 4 [ 6 marks] The juice from freshly pressed apples is often cloudy. This cloudiness can be cleared by using the enzyme pectinase. A student carried out an investigation into the action of pectinase on the cloudy juice from freshly pressed apples. Four test-tubes were set up with different contents as follows: Test-tube Contents 1 10cm3 apple juice + 1cm3 pectinase solution 2 10cm3 apple juice + 1cm3 distilled water 3 10cm3 distilled water + 1cm3 pectinase solution 4 10cm3 apple juice + 1cm3 boiled pectinase solution Each test-tube was shaken thoroughly and then placed in a water bath that are maintained at 40oC for 60 minutes. At regular intervals, samples were taken from each test-tube and tested to measure the percentage of light that passed through the sample. The percentage transmission of light was plotted on a graph.

Anderson Serangoon Junior College Biology Department 5 JC1 H2 BIOLOGY December Revision Package Fig 4.1 shows the graph obtained for test tube 1 and 4. Fig 4.1 (i) Using the information in Fig 4.1, describe and explain the results obtained for test tubes 1 and 4. [3] (ii) Explain why test-tube 2 was included in the experiment. [2] (iii) Sketch on the graph the results you would expect for test-tube 3. [1]

Anderson Serangoon Junior College Biology Department 6 JC1 H2 BIOLOGY December Revision Package Topic: CELL AND NUCLEAR DIVISION Question 5 [10 marks] Fig. 5.1 below shows nuclear division occurring in an animal cell. Fig. 5.1 (a) (i) Identify stages A to D. [2] (ii) State the type of nuclear division shown in Fig. 5.1 [1] (iii) Explain your answer to part (ii). [1] A B C D

Anderson Serangoon Junior College Biology Department 7 JC1 H2 BIOLOGY December Revision Package The graph below shows the relative amounts of DNA per cell during two successive cell divisions in a plant. (b) Describe the events occurring at X. [3] (c) Draw the behaviour of the chromosomes undergoing anaphase II during nuclear division in the cell given below where (2n = 6). [3]

Anderson Serangoon Junior College Biology Department 8 JC1 H2 BIOLOGY December Revision Package Topic: DNA REPLICATION Question 6 [ 12 marks] ACJC Prelims 2010 The herpes simplex virus is an enveloped DNA virus. Viral DNA enters the nucleus of the host cell via the nuclear pores and directs synthesis of viral RNA and DNA. The virus is able to grow in non - dividing cells because its genome encodes enzymes such as viral DNA polymerase and thymidine kinase. Thymidine kinase is involved in synthesising dexoyribonucleotides required for DNA replication. (a) Describe the normal function of nuclear pores. [2] (b) Explain the importance of DNA replication prior to mitosis. [2] (c) Describe the importance of complementary base pairing in DNA replication. [2] (d) Explain why synthesis of DNA occurs both continuously and discontinuously during DNA replication. [2] (e) Acyclovir is an anti-viral drug which is used to treat herpes. It prevents the complete replication of viral DNA by viral DNA polymerase. The structure of acyclovir is shown below in Fig. 9.1. Fig.9.1 When acyclovir enters the infected cell, it is first phosphorylated by thymidine kinase and subsequently becomes further phosphorylated by host cell kinases. When this phosphorylated acyclovir is incorporated into the newly -synthesised DNA strand, it prevents further elongation of the DNA strand. (i) With reference to Fig. 9.1, suggest how the incorporation of the phosphorylated acyclovir prevents further elongation of the DNA strand. [2] (ii) Some strains of herpes simplex virus are now resistant to acyclovir. Suggest how the virus has gained resistance to this anti-viral drug. [2]

Anderson Serangoon Junior College Biology Department 9 JC1 H2 BIOLOGY December Revision Package Topic: PROTEIN SYNTHESIS Question 7 [ 10 marks] Fig. 10 .1 below shows an overview of the synthesis of proteins based on the genetic information contained in the nucleus in a plant cell. (a) Label processes A and B. [1] (b) In order for process A to occur, the DNA double helix must first be unzipped by enzymes. In vitro, DNA strands can also be separated by heat – denaturation of DNA. (i) Explain how DNA is denatured by heat. [1] A B C Fig. 10.1

Anderson Serangoon Junior College Biology Department 10 JC1 H2 BIOLOGY December Revision Package Two DNA segments are shown below. CTAGCTGAACGCGCCCGATT TAAGCTTAACGCGACTGATA GATCGACTTGCGCGGGCTAA ATTCGAATTGCGCTGACTAT Segment 1 Segment 2 (ii) Identify the segment that would require a higher tempe